sunshyneee sunshyneee
  • 04-05-2018
  • Mathematics
contestada

help me pls with the answers pls, identify each pair of angles as complementary,supplementary, or neither

help me pls with the answers pls identify each pair of angles as complementarysupplementary or neither class=

Respuesta :

ktreyb
ktreyb ktreyb
  • 04-05-2018
1. Neither
2. Supplementary
3. Supplementary

4. Complementary
40 + 2x = 90
2x = 50
x = 25

5. Supplementary
6x + 60 = 180
6x = 120 
x = 20
Answer Link
zebaanjum2005
zebaanjum2005 zebaanjum2005
  • 04-05-2018
1. None
2. Supplementary
3. Complementary
sorry i am not sure about 4 and 5.
Answer Link

Otras preguntas

How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Do you think then solid can undergo convection
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the bombing of Hiroshima and Nagasaki resulted in
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
round 7,782 to the nearest hundred