gilliam4284 gilliam4284
  • 02-03-2018
  • History
contestada

How did the great depression crush some people's ability to achieve the american dream?

Respuesta :

15pbinnie
15pbinnie 15pbinnie
  • 02-03-2018
The Unemployment rate changed to 25% and the economical Effects meant people lost a great deal of money and soon went into dept while wages weren't enough to cover living costs the rate & the amount of poor people living in unacceptable conditions rose
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
four yardequal Blank feet
is a centimeter one tenth or one hundredth or a meter
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
i need help with #3
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
The section of the small intestine between the duodenum and ilium?
testosterone directly affects the