DalayahS415 DalayahS415
  • 03-12-2015
  • Mathematics
contestada

Write to decimals whose quotient is close to 2.3

Respuesta :

redcloud redcloud
  • 03-12-2015
4.6/2=2.3 so for two decimals 4.6/2.1 is almost 2.3
Answer Link

Otras preguntas

Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What was religion like in Shang China?
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
what's the percentage of 1/8 ?
what is the lcd of 10/11,29/44
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?