harrypotter4 harrypotter4
  • 02-11-2017
  • Mathematics
contestada

Please help with 2
What is the corresponding angles and sides and what is the Scale factor?

Please help with 2 What is the corresponding angles and sides and what is the Scale factor class=

Respuesta :

CometZ CometZ
  • 02-11-2017
I'm not sure but I think the corresponding angles would be LK and MN, HG and IJ
Scale factor: 21/4= 3
Answer Link

Otras preguntas

the perimeter of a square 116ft ?
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Do you think then solid can undergo convection
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What property is shown by the equation? 1. 0 ÷ (–6) = 0
Did feudalism create a stable form of government?
The section of the small intestine between the duodenum and ilium?