tpetty374 tpetty374

02-12-2021
Mathematics

contestada

Haley bought 2.5 pounds of almonds for $16.20. How much did she pay per pound for the almonds?

Respuesta :

rsophiar20 rsophiar20

02-12-2021

Answer:

0.15432098765

Answer Link

Otras preguntas

please help me w this, i'll mark brainliest if it's correct !!!! :)))

Tyron left his house and drove 30 miles north, then 17 miles east. Birds eye view, how far is he from his house? Round to the nearest tenth. pls hurry it’s for

PLEASE HELP ASAP !!! The model represents mutations in two non-homologous chromosomes. The letters represent genes.what does this model represent? a ) transloc

Can someone help me please I don’t know if I did it right.

Which statement best describes how the Second Great Awakening differed from the First Great Awakening? A) The first inspired a political revolution while the Se

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

In ANOP, the measure of

PLZ HELP!! Which of the following could be the lengths of the sides of a 30°-60°-90° triangle?

irections: Find the area of each figure round to the nearest tenth where necessary. 2

The average person should consume anywhere between 9-12 grams of salt per day to stay healthy. * 1 point True False