1131910 1131910

01-10-2021
Chemistry

contestada

what are the two most common elements found in the universe?

Respuesta :

Velveryy Velveryy

01-10-2021

Answer:

That would be hydrogen and helium! :)

Answer Link

Otras preguntas

Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.

2. For centuries, Africans enslaved other Africans. Name the two later slave trades that transported millions of Africans to distant lands to work.

help pls :) I am stuck on this chemistry question about percentage yields!

The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

What is the value of x?

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D