Seudónimo Seudónimo

03-02-2021
Mathematics

contestada

5th grade math. Correct answer will be marked brainliest.

5th grade math Correct answer will be marked brainliest class=

Respuesta :

rorycampbell0721 rorycampbell0721

03-02-2021

Answer:

0.065

Step-by-step explanation:

64.9 / 1000 = 0.0649 --> 0.065

Answer Link

jane12344 jane12344

03-02-2021

Answer:

15.406 kg of sugar per muffin. Just have to divide 1,000 by 64.9

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Give two reasons that older adults face a greater risk of vitamin d deficiency than younger people?

A major weakness of the new constitution was the bill of rights. a. True b. False

One of the benefits that the gi bill of rights offered to returning veterans was

Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.

Studies of populations that reveal correlations between dietary habits and disease incidence are

why does the troposphere experience the greatest amount of atmospheric pressure compared to the other atmospheric layers?

Simplify the expression completely. x squared over x to the power of 6

A promissory note Question 12 options: is a written promise to pay. is an oral promise to pay. entitles the maker to a discount. is due in 30 days.

How did japan gain territory and control of areas of china during world war 1?