dayrinemartinez dayrinemartinez
  • 03-12-2020
  • Mathematics
contestada

Paul joins a gym that has an initial membership fee of $75 and a monthly cost of $40. How much will they have paid after 4 months? *

Respuesta :

ecosmii
ecosmii ecosmii
  • 03-12-2020
$235 total. 75 + 40(4). then simplify. 75 + 160 = 235
Answer Link

Otras preguntas

Whoever answers I’ll mark them brainliest!
what is the following answer for 7/4 x 10? (1) 14 (2) 18 1/4 (3) 28 (4)30 1/2
A bus leaves Flacq at 07 05 and reaches Curepipe at 08 50, after travelling a distance of 91 kilometres. Find the average speed of the bus, giving your answer i
Without multiplying, tell whether the value of the expression is positive or negative. Explain your reasoning. 1.) -1(4/5) 2.) 4/7 (-3 1/2) 3.) -0.25 (-3.659
Authority that is a function of explicit laws or rules that define the legitimate uses of power is
what social struggles and student movements led to black studies?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
A block of metal has a volume of 56,000cm3 and a mass of 280,000 g find the density of the metal in kg/m3
anong salita ang hindi dapat mapabilang sa pangkat dahil aa naiibang uri nito?a.anob.kailanmanc.saand.sino​
What did Hitler believe he had failed in Czechoslovakia?