porseybigglesl porseybigglesl

03-10-2016
Mathematics

contestada

What is two to the fourth power multiplied by four to the second power?

Respuesta :

NotSoGood NotSoGood

03-10-2016

2 to the fourth power is technically
2 × 2 × 2 × 2 = 16
4 to the second power is
4 × 4 = 16
The answer is 256

Answer Link

Otras preguntas

(giving 30 points/need answers STAT!!)Four transformations of the function f(x) = 3x + 2 are given below.For each transformation, drag the expression that shows

How are the solutions to the inequality -2x ≥ 10 different from the solutions to -2x > 10? Explain your reasoning.

Simplify: –3(y + 2)^2 – 5 + 6y

what is the simplest form of 2 sq root 3/ sq root 6

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Thedreaded pathogenic bacterium J. grocious makes a toxin called BalD. There are two allelic forms of balD, with the balD-1 allele encoding the more potent form

Rewrite the quadratic equation 2x squared plus 12x plus 1 equal y

Where is the kingdom of Israel located?

The frequency of data is the higest at

On October 1, 2013, Holt Company places a new asset into service. The cost of the asset is $80,000 with an estimated 5-year life and $20,000 salvage value at th