stephaniemia61 stephaniemia61

02-09-2020
Computers and Technology

contestada

In Marvel Comics, what imaginary rare metal is an important natural resource of Wakanda, the home country of Black Panther?

Respuesta :

icoolguy43110 icoolguy43110

02-09-2020

Answer:

vinranium

Explanation:

i watched the movie

IM SO SMART!!!!!!!!!!!!! UWU

Answer Link

Otras preguntas

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?

What was a muckraker? A. A writer who exposed abuses of businesses and government B. A writer who wrote scandalous fiction C. A person who work

What was OPEC protesting when it imposed it's embargo?

If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system

What is the value of [(2/3)^0]^-3

Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re

which combination of quarks produces a neutral baryon

Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en

help me asap !!!!!!!!

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat