fabi22551 fabi22551
  • 04-07-2018
  • Computers and Technology
contestada

Which linux file instructs linux about which folders to share with nfs?

Respuesta :

lilaipo
lilaipo lilaipo
  • 14-07-2018

The answer is : /etc/exports file. It is the Linux file that instructs Linux which folders to share with NFS and what NFS features should be enabled. It controls which file systems are exported to remote hosts and specifies options. It contains a table of local physical file systems on an NFS server that are accessible to NFS clients.

Answer Link

Otras preguntas

Did feudalism create a stable form of government?
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
why did russia have revolution in 1917?
how do you say theatre in Spanish
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Please help solve, thanks in advance!
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
accurate estimation 719-348
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?